affinity chromatography-based purification of pertactin using high-affinity ligands Search Results


99
Thermo Fisher base pair hplc purified dna oligo
Base Pair Hplc Purified Dna Oligo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/DNA/bio_rxiv__2020__06__03__132233-397-3-9
Average 99 stars, based on 1 article reviews
base pair hplc purified dna oligo - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
Metabion International AG hplc purified dna sequences
Hplc Purified Dna Sequences, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/hplc+purified/pmc05486112-158-0-7
Average 90 stars, based on 1 article reviews
hplc purified dna sequences - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
biomers.net gmbh pcr oligo (hplc purified

Pcr Oligo (Hplc Purified, supplied by biomers.net gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/pcr+oligo++hplc+purified/pmc07162653-51-4-9
Average 90 stars, based on 1 article reviews
pcr oligo (hplc purified - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Metabion International AG 32-nucleotide single-stranded dna aptamer probe e1

32 Nucleotide Single Stranded Dna Aptamer Probe E1, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/32+nucleotide+single+stranded+dna+aptamer+probe+e1/pmc11203472-144-6-26
Average 90 stars, based on 1 article reviews
32-nucleotide single-stranded dna aptamer probe e1 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Dr Maisch HPLC reprosil-pur c18-aq (3-μm bead diameter

Reprosil Pur C18 Aq (3 μm Bead Diameter, supplied by Dr Maisch HPLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/reprosil+pur+c18+aq+resin/pmc04651294-285-22-27
Average 90 stars, based on 1 article reviews
reprosil-pur c18-aq (3-μm bead diameter - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Merck & Co high throughput protein a based mabselect affinity chromatography

High Throughput Protein A Based Mabselect Affinity Chromatography, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/chromatography+high+liquid+performance/pmc12807537-35-5-31
Average 86 stars, based on 1 article reviews
high throughput protein a based mabselect affinity chromatography - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
biomers.net gmbh oligo-dt30vn (hplc purified

Oligo Dt30vn (Hplc Purified, supplied by biomers.net gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/oligo+dt30vn+primer/pmc07162653-50-3-7
Average 90 stars, based on 1 article reviews
oligo-dt30vn (hplc purified - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

86
Sangon Biotech hplc purified dna sequences

Hplc Purified Dna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/dna+sequences/pm31584808__ja9b05063_si_001-49-0-10
Average 86 stars, based on 1 article reviews
hplc purified dna sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
BOC Sciences cap0 rna

Cap0 Rna, supplied by BOC Sciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/Tubercidin/bio_rxiv__2024__03__13__583470-258-22-33
Average 93 stars, based on 1 article reviews
cap0 rna - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Prosep Inc protein a affinity chromatography resins prosep-va high capacity

Protein A Affinity Chromatography Resins Prosep Va High Capacity, supplied by Prosep Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/affinity+chromatography+prosep+va+ultra/us08338577-158-1-10
Average 90 stars, based on 1 article reviews
protein a affinity chromatography resins prosep-va high capacity - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Dr Maisch HPLC c4 beads

C4 Beads, supplied by Dr Maisch HPLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/affinity+chromatography-based+purification+of+pertactin+using+high-affinity+ligands/c4+beads/pmc03471440-51-43-50
Average 90 stars, based on 1 article reviews
c4 beads - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Journal: eLife

Article Title: Cell type composition and circuit organization of clonally related excitatory neurons in the juvenile mouse neocortex

doi: 10.7554/eLife.52951

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , IS PCR Oligo (HPLC purified) , Biomers.net , oligonucleotide , 5’- AAGCAGTGGTATCAACGCAGAGT -3’.

Techniques: Recombinant, Sequencing, Plasmid Preparation, Purification, Software

Journal: eLife

Article Title: Cell type composition and circuit organization of clonally related excitatory neurons in the juvenile mouse neocortex

doi: 10.7554/eLife.52951

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , Oligo-dT30VN (HPLC purified) , Biomers.net , oligonucleotide , 5’- AAGCAGTGGTATCAACGCAGAGTAC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3’, where V represents A, C or G and N represents any nucleotide.

Techniques: Recombinant, Sequencing, Plasmid Preparation, Purification, Software